Primers for amplifying and sequencing fungal DNA
| Primer name | Sequence | Gene or locus | Direction | Reference |
| ITS1 | TCCGTAGGTGAACCTGCGG | ITS | Forward | White et al. (1990) |
| ITS1-F | CTTGGTCATTTAGAGGAAGTAA | ITS | Forward | Gardes and Bruns (1993) |
| ITS5 | GGAAGTAAAAGTCGTAACAAGG | ITS | Forward | White et al. (1990) |
| ITS4 | TCCTCCGCTTATTGATATGC | ITS | Reverse | White et al. (1990) |
| LR0R | ACCCGCTGAACTTAAGC | LSU | Forward | Hopple and Vilgalys (1994) |
| LR5 | TCCTGAGGGAAACTTCG | LSU | Reverse | Hopple and Vilgalys (1994) |
| LR7 | TACTACCACCAAGATCT | LSU | Reverse | Hopple and Vilgalys (1994) |
| RPB1-Af | GARTGYCCDGGDCAYTTYGG | RPB1 | Forward | Stiller and Hall (1997) |
| RPB1-Cr | CCNGCDATNTCRTTRTCCATRTA | RPB1 | Reverse | Matheny et al. (2002) |
| bRPB2-6F | TGGGGYATGGTNTGYCCYGC | RPB2 | Forward | Matheny (2005) |
| bRPB2-7.1R | CCCATRGCYTGYTTMCCCATDGC | RPB2 | Reverse | Matheny (2005) |
| EF1-983F | GCYCCYGGHCAYCGTGAYTTYAT | TEF1 | Forward | Rehner and Buckley (2005) |
| EF1-1567R | ACHGTRCCRATACCACCSATCTT | TEF1 | Reverse | Rehner and Buckley (2005) |
References
Gardes, M., & Bruns, T. D. (1993). ITS primers with enhanced specificity for basidiomycetes–application to the identification of mycorrhizae and rusts. Molecular Ecology, 2, 113–118. https://doi.org/10.1111/j.1365-294x.1993.tb00005.x
Hopple, J. S., & Vilgalys, R. (1994). Phylogenetic relationships among coprinoid taxa and allies based on data from restriction site mapping of nuclear rDNA. Mycologia, 86(1), 96–107. https://doi.org/10.1080/00275514.1994.12026378
Matheny, P. B. (2005). Improving phylogenetic inference of mushrooms with RPB1 and RPB2 nucleotide sequences (Inocybe; Agaricales). Molecular Phylogenetics and Evolution, 35(1), 1–20. https://doi.org/10.1016/j.ympev.2004.11.014
Rehner, S. A., & Buckley, E. (2005). A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia, 97(1), 84–98. https://doi.org/10.1080/15572536.2006.11832842
Stiller, J. W., & Hall, B. D. (1997). The origin of red algae: Implications for plastid evolution. Proceedings of the National Academy of Sciences, 94(9), 4520–4525. https://doi.org/10.1073/pnas.94.9.4520
White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols (pp. 315–322). Elsevier. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Online sources
Primer Sequences – Lutzoni Lab
Last modified:
Cristian Riquelme 